View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14473_high_61 (Length: 270)
Name: NF14473_high_61
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14473_high_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 8441481 - 8441228
Alignment:
| Q |
1 |
gaaaatataaggtttggttaggtcc-tatggtgttggaatcagcttttcaaccatttcatgctttggttgtcttttaacttgttgatcaaattatcatca |
99 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8441481 |
gaaaatataaggtttggttaggtccctatggtgttggaatcaacttttcaaccatttcatgctttggttgtcttttaacttgttgatcaaattgacatca |
8441382 |
T |
 |
| Q |
100 |
ttgagatcacttgtaattgtggtgaaaacgcgactgcagtaagatagaataaaaaagctgttggttagagattgtgtgtgcagtaagataaataaaacag |
199 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8441381 |
ttgagatcacttgtagttgtggtcaaaacgcgactgcagtaagataaaataaaaaagctgttggttagagattgtgtgtgcagtaagataaataaaaagg |
8441282 |
T |
 |
| Q |
200 |
tgttggttagagattgtgtgtgcccctctacgggctgatccaagcataaaactg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8441281 |
tgttggttagagattgtgtgtgcccctctacgggctgatccaagcataaaactg |
8441228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 70
Target Start/End: Complemental strand, 8443242 - 8443177
Alignment:
| Q |
7 |
ataaggtttggttaggtcc-tatggtgttggaatcagctttt-caaccatttcatgctttggttgt |
70 |
Q |
| |
|
||||||||||| ||||||| |||| ||||| ||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
8443242 |
ataaggtttggctaggtccctatgatgttgaaatcagcttttgcaaccctttcatgctttggttgt |
8443177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University