View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14473_high_65 (Length: 248)
Name: NF14473_high_65
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14473_high_65 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 14121519 - 14121762
Alignment:
| Q |
1 |
tttgatgttttgtgtggttccttgcccgagtggtaacggtattcataactgaacttgtcctttctattgcaaacatttgtaacacatattaggttgcatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14121519 |
tttgatgttttgtgtggttccttgcccgagtggtaacggtattcataactgaacttgtcctttctattgcaaacatttgtaacacatattaggttgcatc |
14121618 |
T |
|
| Q |
101 |
atagatttattgaatatttcatgtgactaattaaataagaagaaaatcattggattaggtctaacggaagatattagactcttacaatatgtcgagtcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||||||||||| |
|
|
| T |
14121619 |
atagatttattgaatatttcatgtgactaattaaataagaagaaaatcattggattaggtctaacggaagatatcatactcttacagtatgtcgagtcaa |
14121718 |
T |
|
| Q |
201 |
ggtttgaatatcagattcaatatttagtactagatattcttcga |
244 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||| |||||| |
|
|
| T |
14121719 |
ggtttgaatatcagatgcaatatttagtaccagatatgcttcga |
14121762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University