View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14473_high_73 (Length: 226)

Name: NF14473_high_73
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14473_high_73
NF14473_high_73
[»] chr8 (1 HSPs)
chr8 (12-168)||(39467929-39468085)


Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 12 - 168
Target Start/End: Complemental strand, 39468085 - 39467929
Alignment:
12 gcagcacagaaaattgtagaagaattggaatgagaattaaggttttgaaatgaaagtgaaattggaggaaatatgtgtgatttgagagagacacaggact 111  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39468085 gcagtacagaaaattgtagaagaattggaatgagaattaaggttttgaaatgaaagtgaaattggaggaaatatgtgtgatttgagagagacacaggact 39467986  T
112 tgaaaattgcaactgctgctgctgaggagcaacgtagcgccatactccctttccccc 168  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39467985 tgaaaattgcaactgctgctgctgaggagcaacgtagcgccatactccctttccccc 39467929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University