View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14473_high_73 (Length: 226)
Name: NF14473_high_73
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14473_high_73 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 12 - 168
Target Start/End: Complemental strand, 39468085 - 39467929
Alignment:
| Q |
12 |
gcagcacagaaaattgtagaagaattggaatgagaattaaggttttgaaatgaaagtgaaattggaggaaatatgtgtgatttgagagagacacaggact |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39468085 |
gcagtacagaaaattgtagaagaattggaatgagaattaaggttttgaaatgaaagtgaaattggaggaaatatgtgtgatttgagagagacacaggact |
39467986 |
T |
 |
| Q |
112 |
tgaaaattgcaactgctgctgctgaggagcaacgtagcgccatactccctttccccc |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39467985 |
tgaaaattgcaactgctgctgctgaggagcaacgtagcgccatactccctttccccc |
39467929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University