View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14473_high_74 (Length: 224)
Name: NF14473_high_74
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14473_high_74 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 5391590 - 5391378
Alignment:
| Q |
12 |
taagtataatctgacgaagaattgttccaagccgtccaaatttaaaagattgtaaacattaataacgtggatatnnnnnnntagttttgccaggaaacac |
111 |
Q |
| |
|
|||||||||| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5391590 |
taagtataatttgacaaagaattgttccaggccgtccaaatttaaaagattgtaaacattaataacgtggatataaaaaaatagttttgccaggaaacac |
5391491 |
T |
 |
| Q |
112 |
cagctgtaactgaaaagtatatataaaccgttacagaggctgagccacttgcggttcgtaccaaaccactttcaatcttcctatttcgtaccataccatt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5391490 |
tagctgtaactgaaaagtatatataaaccgttacagagcctgagccacttgcggttcgtaccaaaccactttcaatcttcctatttcgtaccataccatt |
5391391 |
T |
 |
| Q |
212 |
actgaatctatct |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5391390 |
actgaatctatct |
5391378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University