View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14473_high_75 (Length: 221)

Name: NF14473_high_75
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14473_high_75
NF14473_high_75
[»] chr5 (1 HSPs)
chr5 (14-205)||(8554412-8554603)


Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 8554412 - 8554603
Alignment:
14 gcaaagggaaagaaaacttgaaataatagtataaagtttttcatgtcaataacttaccctaaaactcttttccatggggacagatccatatccatagtta 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8554412 gcaaagggaaagaaaacttgaaataatagtataaagtttttcatgtcaataacttaccctaaaactcttttccatggggacagatccatatccatagtta 8554511  T
114 ccaatctggcctacagtaaccatctcagcagaagaacatgaagcagaagaaagccctaaataaacacacacacaaaaattaatataggatat 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8554512 ccaatctggcctacagtaaccatctcagcagaagaacatgaagcagaagaaagccctaaataaacacacacacaaaaattaatataggatat 8554603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University