View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14473_low_25 (Length: 401)
Name: NF14473_low_25
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14473_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 20 - 391
Target Start/End: Original strand, 50574502 - 50574876
Alignment:
| Q |
20 |
ttaacttcacttttggaccgagtcatatagt---agtaattaagcatcactatcagtatcactgctgcttatgatatcaaaacggagcagatgaaagaat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50574502 |
ttaacttcacttttggaccgagtcatatagtagtagtaattaagcatcactatcagtatcactgctgcttatgatatcaaaacggagcagatgaaagaat |
50574601 |
T |
|
| Q |
117 |
ctacaatgaaccaaaaggcacatggcattacgtgatcacaaaccacttcttatccttgactctgtctttttaccatctgattcgtatgtgattaggttcc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
50574602 |
ctacaatgaaccaaaaggcacatggcattacgtgatcacaaaccacttcttatccttgactctgtcttttaaccatctgatacgtatgtgattaggttcc |
50574701 |
T |
|
| Q |
217 |
tatatatataatacaatagtgcccaacaatccaattcataaacactcgttaacattaatatcactaggaatagttactgtcccctaaaaaatggctatga |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50574702 |
tatatatataatacaatagtgcccaacaatccaattcataaacactcgttaacattaatatcactaggaatagttactgtcccctaaaaaatggctatga |
50574801 |
T |
|
| Q |
317 |
agttagcaatattattgtgtttggtgatactcaacctcacttcagcatttgcagccagagtgaatgatgcctatg |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50574802 |
agttagcaatattattgtgtttggtgatactcaacctcacttcagcatttgcagccagagtgaatgatgcctatg |
50574876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University