View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14473_low_27 (Length: 396)
Name: NF14473_low_27
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14473_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 14 - 381
Target Start/End: Complemental strand, 44333478 - 44333111
Alignment:
| Q |
14 |
agcaaagggattcaggaaagttcgtgaggttgaaggaggaggaacatggtggtgatgagaaagaggaagaagcttcaggatcacatggattgaaccaaca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44333478 |
agcaaagggattcaggaaagttcgtgaggttgaaggaggaggaacatggtggtgatgagaaagaggaagaagcttcaggatcacatggattgaaccaaca |
44333379 |
T |
|
| Q |
114 |
gcagtatggggaggtggcaatgtcttgtcctatggtttcagcgccgactcagcatggattgggccaggcccaaaatgagtgggtccaagtccaacaagga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44333378 |
gcagtatggggaggtggcaatgtcttgtcctatggtttcagcgccgactcagcatggattgggccaggcccaaaatgagtgggtccaagtccaacaagga |
44333279 |
T |
|
| Q |
214 |
agtggttattttccaatgatgtcaggttttgtccctgtctcttctagttctaattctcctcgtatgtattcttctagtgctgctcttttggggtctagtt |
313 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44333278 |
agtggctattttccaatgatgtcaggttttgtccctgtctcttctagttctaattctcctcgtatgtattcttctagtgctgctcttttggggtctagtt |
44333179 |
T |
|
| Q |
314 |
catgggttggacataaaagagtgcgtgaagatggtcttcttaagagtgatgatgctgttggtggttct |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44333178 |
catgggttggacataaaagagtgcgtgaagatggtcttcttaagagtgatgattctgttggtggttct |
44333111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University