View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14473_low_30 (Length: 368)

Name: NF14473_low_30
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14473_low_30
NF14473_low_30
[»] chr3 (1 HSPs)
chr3 (12-179)||(44002035-44002195)


Alignment Details
Target: chr3 (Bit Score: 121; Significance: 6e-62; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 12 - 179
Target Start/End: Complemental strand, 44002195 - 44002035
Alignment:
12 agaatatcaagtgtacagtgtattcaagcataccataaataacgcaatattgcatgattgtgaactatttaaaatttaaaacacaatgagagaaccgacc 111  Q
    |||||||||| |||||||||||| ||||||||||||||    ||||||   |||||||||||||||||||||||||||||||||||||||||||||||||    
44002195 agaatatcaattgtacagtgtatccaagcataccataa----cgcaat---gcatgattgtgaactatttaaaatttaaaacacaatgagagaaccgacc 44002103  T
112 gctttaacaaataaaacaagtgaaaataatagcaatttgtcaaattttgtttcatcaaccattgatta 179  Q
    ||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
44002102 gctctaacaaataaaacaagtgaaaataatatcaatttgtcaaattttgtttcatcaaccattgatta 44002035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University