View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14473_low_38 (Length: 332)

Name: NF14473_low_38
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14473_low_38
NF14473_low_38
[»] chr7 (1 HSPs)
chr7 (43-90)||(39428824-39428871)


Alignment Details
Target: chr7 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 39428871 - 39428824
Alignment:
43 aatatttggattcaagaggaaaaaacattttttacttatttggaatgg 90  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||    
39428871 aatatttggattcaagaggaaaaaacattttttatttatttggaatgg 39428824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University