View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14473_low_38 (Length: 332)
Name: NF14473_low_38
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14473_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 43 - 90
Target Start/End: Complemental strand, 39428871 - 39428824
Alignment:
| Q |
43 |
aatatttggattcaagaggaaaaaacattttttacttatttggaatgg |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39428871 |
aatatttggattcaagaggaaaaaacattttttatttatttggaatgg |
39428824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University