View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14473_low_55 (Length: 287)

Name: NF14473_low_55
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14473_low_55
NF14473_low_55
[»] chr5 (1 HSPs)
chr5 (143-277)||(33442058-33442192)


Alignment Details
Target: chr5 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 143 - 277
Target Start/End: Original strand, 33442058 - 33442192
Alignment:
143 ttcgcgagcgctcacacagtgattctactactctgtcccgtgatgtttctatgtgttgtatgaagggaaagataactttgccttatatgattgaacctcc 242  Q
    |||||||||||||||  || || ||| ||||| |||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
33442058 ttcgcgagcgctcacgtagggactcttctactttgtcccatgatgtttcaatgtgttgtatgaagggaaagataactttgccttatatgattgaacctcc 33442157  T
243 accctttctgcgtcaacttttcaatggtcttcatc 277  Q
     ||||| || |||||||||||||||||||||||||    
33442158 tcccttgctccgtcaacttttcaatggtcttcatc 33442192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University