View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14473_low_57 (Length: 283)
Name: NF14473_low_57
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14473_low_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 160 - 264
Target Start/End: Complemental strand, 34953610 - 34953506
Alignment:
| Q |
160 |
ttgtttggtttgagtttttgttggttctatcagcaagaacaatcaccaacagtttctcattctggagacagttatttttgtttccacttatgaagtagtg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34953610 |
ttgtttggtttgagtttttgttggttctatcagcaagaacaatcaccaacagtttctcattctggagacagttatttttgtttccacttatgaagtagtg |
34953511 |
T |
|
| Q |
260 |
aggac |
264 |
Q |
| |
|
||||| |
|
|
| T |
34953510 |
aggac |
34953506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 13 - 104
Target Start/End: Complemental strand, 34953757 - 34953666
Alignment:
| Q |
13 |
gagatgaaccatctagtactggagaaggtggtgtagatgaaccgtttagtggagaaggtggcggtataggagttaatgcatccgatgagtgt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34953757 |
gagatgaaccatctagtactggagaaggtggtgtagatgaaccgtttagtggagaaggtggcggtataggagttaatgcatccgatgagtgt |
34953666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University