View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14474_high_10 (Length: 441)
Name: NF14474_high_10
Description: NF14474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14474_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 221 - 268
Target Start/End: Original strand, 8521829 - 8521876
Alignment:
| Q |
221 |
agattcttataaaattgtaaaatttcttgtaaaatgggtaaatgatcg |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8521829 |
agattcttataaaattgtaaaatttcttgtaaaatctgtaaatgatcg |
8521876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 58 - 99
Target Start/End: Original strand, 8521790 - 8521831
Alignment:
| Q |
58 |
ttacaccacattggcatcggttctgcataattatgcagcaga |
99 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
8521790 |
ttacaccacattggcatctgctctgcataattatgcagcaga |
8521831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University