View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14474_high_19 (Length: 313)
Name: NF14474_high_19
Description: NF14474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14474_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 13 - 298
Target Start/End: Original strand, 42714605 - 42714890
Alignment:
| Q |
13 |
gagaactggtgttattgtcaattcagtatttatgatcacaaaatatcaggtttatttcattttttacttttaatttcatccaccttaaaacattcgaaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42714605 |
gagaactggtgttattgtcaattcagtatttatgatcacaaaatgtcaggtttatttcattttttacttttaatttcatccaccttaaaacattcgaaaa |
42714704 |
T |
 |
| Q |
113 |
ctgaacattgcatattcccttccatcttgagagaactcgtgcattgcaaataccatnnnnnnncctttattgcaatgggaagaaaaagaaatacatcact |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42714705 |
ctgaacattgcatattcccttccatcttgagagaactcgtgcattgcaaataccataaaaaaacctttattgcaatgggaagaaaaagaaatacatcact |
42714804 |
T |
 |
| Q |
213 |
tttaatagttgatagcaaatgtattattatgaaactaatacctcactaatgtggattgttaagtgcaataggtatcccaacaacat |
298 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42714805 |
tttaatagttggtagcaaatgtattattatgaaactaatacctcactaatgtggattgttaagtgcaataggtatcccaacaacat |
42714890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University