View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14474_low_11 (Length: 438)
Name: NF14474_low_11
Description: NF14474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14474_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 2e-47; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 38 - 188
Target Start/End: Original strand, 30480880 - 30481030
Alignment:
| Q |
38 |
aatataaggtaaatatgatttgatcatgtaaaggagaaagta----cagaattcggccactcactcactgcaggtctctctgaaactcaacctggttcgt |
133 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||| || || ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30480880 |
aatataagataaatatgatttgattatgtaaaggagaaattaaggacacaattcggccactcactcactgcaagtctctctgaaactcaacctggttcgt |
30480979 |
T |
|
| Q |
134 |
cgatgttgatctctatctctctcgctcgctcgctaccgcacctgtctcacgcgcg |
188 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
30480980 |
cgatgttgatctctatctct----ctcgctcgctaccgcacctgtctcactcgcg |
30481030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 297 - 350
Target Start/End: Original strand, 30502526 - 30502579
Alignment:
| Q |
297 |
aaacatcaataaatctcaaacatttttagatcaaagagcggagagtttttattt |
350 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
30502526 |
aaacataaataaatctcaaacatttttggatcaaagatgggagagtttttattt |
30502579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 156
Target Start/End: Original strand, 30514134 - 30514167
Alignment:
| Q |
123 |
acctggttcgtcgatgttgatctctatctctctc |
156 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
30514134 |
acctggttggtcgatgttgatctctatctctctc |
30514167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University