View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14474_low_15 (Length: 407)
Name: NF14474_low_15
Description: NF14474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14474_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 22 - 395
Target Start/End: Complemental strand, 37584835 - 37584458
Alignment:
| Q |
22 |
gaggcgttttgatttgaaacagtgtgttcaccaatggcatcagtattccgtagggtaatgttgaaattatcagcaacgcggtggtcggagctcataaaca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37584835 |
gaggcgttttgatttgaaacagtgtgttcgccaatggcatcagtattccgtagggtaatgttgaaattatcagcaacgcggtggtcggagctcataaaca |
37584736 |
T |
 |
| Q |
122 |
tctccattgtggatgaatttgtgtggggaatcgttacggctttcgagtcagtcgctcttgtctctatgctctgcttcttcttcctgtcctatggctgcac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37584735 |
tctccattgtggatgaatttgtgtggggaatcgttacggctttcgagtcagtcgctcttgtctctatgctctgcttcttcttcctgtcctatggctgcac |
37584636 |
T |
 |
| Q |
222 |
catctgatccataacaccaagaagctattgtc----cctcatgcatgtgaatctggcgttttttcttctcttgagtagtttttcccctttataagttgtg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37584635 |
catctgatccataacaccaagaagctattgtccctccctcatgcatgtgaatctggcgttttttcttctcttgagtagtttttcccctttataagttgtg |
37584536 |
T |
 |
| Q |
318 |
ttgggtgaattagtttcttcaattttatttttgtaatccagttgttgattgtagttgaaaattttggatgatgataat |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37584535 |
ttgggtgaattagtttcttcaattttatttttgtaatccagttgttgattgtagttgaaaattttggatgatgataat |
37584458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University