View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14474_low_18 (Length: 343)
Name: NF14474_low_18
Description: NF14474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14474_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 11 - 150
Target Start/End: Complemental strand, 46033113 - 46032974
Alignment:
| Q |
11 |
attattagatggcatcgaagaggacatctgatactagtgatagttgtgatgacaatgttacttcaaccagtactaagcgaataaaacaacatgatattca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46033113 |
attattagatggcatcgaagaggacatctcatactagtgatagttgtgatgacaatgttacttcaaccagtactaagcgaataaaacaacatcatattca |
46033014 |
T |
|
| Q |
111 |
tgggaatctagaagaagaacaacaaaaggagatccaacac |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46033013 |
tgggaatctagaagaagaacaacaaaaggagatccaacac |
46032974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 244 - 332
Target Start/End: Complemental strand, 46032882 - 46032789
Alignment:
| Q |
244 |
gcactatcagtgccactgcattcttcttttgcctggaacccttacttcgaaaactggtaattaa-----ctaaccctcttactttcttcccttt |
332 |
Q |
| |
|
|||||||||||||| ||||||| ||| || ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46032882 |
gcactatcagtgcctctgcattagccttacgcttggaacccttacttcgaaaactggtaattaactaaactaaccctcttactttcttcccttt |
46032789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University