View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14474_low_28 (Length: 205)

Name: NF14474_low_28
Description: NF14474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14474_low_28
NF14474_low_28
[»] chr1 (1 HSPs)
chr1 (18-193)||(43864154-43864329)


Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 193
Target Start/End: Original strand, 43864154 - 43864329
Alignment:
18 catgggaccatgcgagtgtgtcgttgacgttgggttgagcagcaactgattcagggatagggcggttggcgaaggattggtcgnnnnnnnggaggatttc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||    
43864154 catgggaccatgcgagtgtgtcgttgacgttgggttgagcagcaactgattcagggatagggcggttggcgaaggattggtcgtttttttggaggatttc 43864253  T
118 ttgggcggttgtcggggaggaagcaacggtgacggtgacggagccgaagcggagggacatgatggggccacaggtt 193  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
43864254 ttgggcggttttcggggaggaagcaacggtgacggtgacggagccgaagcggagggacatgatggggccataggtt 43864329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University