View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14474_low_28 (Length: 205)
Name: NF14474_low_28
Description: NF14474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14474_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 193
Target Start/End: Original strand, 43864154 - 43864329
Alignment:
| Q |
18 |
catgggaccatgcgagtgtgtcgttgacgttgggttgagcagcaactgattcagggatagggcggttggcgaaggattggtcgnnnnnnnggaggatttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43864154 |
catgggaccatgcgagtgtgtcgttgacgttgggttgagcagcaactgattcagggatagggcggttggcgaaggattggtcgtttttttggaggatttc |
43864253 |
T |
|
| Q |
118 |
ttgggcggttgtcggggaggaagcaacggtgacggtgacggagccgaagcggagggacatgatggggccacaggtt |
193 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43864254 |
ttgggcggttttcggggaggaagcaacggtgacggtgacggagccgaagcggagggacatgatggggccataggtt |
43864329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University