View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14475_high_10 (Length: 421)
Name: NF14475_high_10
Description: NF14475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14475_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 14 - 53
Target Start/End: Complemental strand, 52237465 - 52237426
Alignment:
| Q |
14 |
atatccttaccaaaatgttgtaattcaaaactttgaagac |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52237465 |
atatccttaccaaaatgttgtaattcaaaactttgaagac |
52237426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University