View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14475_high_35 (Length: 231)
Name: NF14475_high_35
Description: NF14475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14475_high_35 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 94 - 231
Target Start/End: Original strand, 28823602 - 28823740
Alignment:
| Q |
94 |
caactcgctgcgccacgagaattgagaaactagtaattgctgggggagaactgaaaaacaacagatcacattgtattcctttgacaacttccaagcagat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28823602 |
caactcgctgcgccacgagaattgagaaactagtaattgctgggggagaactgaaaaacaacagatcacattgtattcctttgacaacttccaagcagat |
28823701 |
T |
 |
| Q |
194 |
tcaaaccctaatagacccgatgtgatgatg-tccatctc |
231 |
Q |
| |
|
||||||||||||| |||| |||| ||||| |||||||| |
|
|
| T |
28823702 |
tcaaaccctaataaacccactgtgctgatgctccatctc |
28823740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University