View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14475_low_10 (Length: 421)

Name: NF14475_low_10
Description: NF14475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14475_low_10
NF14475_low_10
[»] chr1 (1 HSPs)
chr1 (14-53)||(52237426-52237465)


Alignment Details
Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 14 - 53
Target Start/End: Complemental strand, 52237465 - 52237426
Alignment:
14 atatccttaccaaaatgttgtaattcaaaactttgaagac 53  Q
    ||||||||||||||||||||||||||||||||||||||||    
52237465 atatccttaccaaaatgttgtaattcaaaactttgaagac 52237426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University