View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14475_low_16 (Length: 364)
Name: NF14475_low_16
Description: NF14475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14475_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 2e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 37 - 222
Target Start/End: Original strand, 43102884 - 43103061
Alignment:
| Q |
37 |
agtgaaccgattgcaagttcaagttctcctaggtagccaaggaacatcatggacaccatggaacgagaatagaaaataagagctgttatgggcctatggc |
136 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43102884 |
agtgaaccggctgcaagttcaagttctcctaggtagcctaaaaacatcatggacaccatggaacgagaatagaaaataagagctgttatg--------gc |
43102975 |
T |
|
| Q |
137 |
tattgggaaaacaaggatcgttagggatttcatttcttccatgatggttgaaaaggaacatgtatttggtttggtgtggtcactta |
222 |
Q |
| |
|
|||||| ||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43102976 |
tattggaaaagcaagcatcattagggatttcatttcttccatgatggttgaaaaggaacatgtatttggtttggtgtagtcactta |
43103061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University