View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14475_low_19 (Length: 339)
Name: NF14475_low_19
Description: NF14475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14475_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 10 - 242
Target Start/End: Complemental strand, 7835440 - 7835207
Alignment:
| Q |
10 |
gcaaaggttaaaaaatatagcttttgaaaaattagaatgaataatctttaattatatcgaattcaccgtggtgccaaattgcaataactcaacccc-act |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7835440 |
gcaaaggttaaaaaatatagcttttgaaaaattagaatgaatgatctt-aattatgtcgaattcaccgtggtgccaaattgcaataactcaacccccact |
7835342 |
T |
 |
| Q |
109 |
caaatagcgataattcaactctactcaaatattacccttgattgaatgtttgtcctagatcagactt-ttttcttacgaaaaggacatttagaaattgnn |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
7835341 |
caaatagcgataattcaactctactcaaatattacccttgattgaatgtttgtcctagatcagactttttttcttacgaaatggacatttagaaattgtt |
7835242 |
T |
 |
| Q |
208 |
nnnnnctcatagatttaaaaattatttgagtaatg |
242 |
Q |
| |
|
||| |||||||||||||||||||||||||| |
|
|
| T |
7835241 |
tttttctcgtagatttaaaaattatttgagtaatg |
7835207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University