View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14475_low_30 (Length: 254)
Name: NF14475_low_30
Description: NF14475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14475_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 14 - 235
Target Start/End: Original strand, 39072316 - 39072537
Alignment:
| Q |
14 |
aatataactatgaactgaactagactagtatttttgaagttgggataggaggggctatagctaggtatatggatcaatctcatgactttgtagaactaca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39072316 |
aatataactatgaactgaactagactagtatttttgaagttgggataggaggggctatagctaggtatatggatcaatctcatgactttgtagaactaca |
39072415 |
T |
 |
| Q |
114 |
ttcgttcaattcaattcaaccactttaatttgctgcactgcaccatgcactaccttttcttttcattcatttgtctacatgctttttgcagtgactcccc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39072416 |
ttcgttcaattcaattcaaccactttaatttgctgcactgcaccatgcactaccttttcttttcattcatttgtctacatgctttttgcagtgactcccc |
39072515 |
T |
 |
| Q |
214 |
tttcagtaaaaaccccttccta |
235 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39072516 |
tttcagtaaaaaccccttccta |
39072537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University