View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14475_low_34 (Length: 236)
Name: NF14475_low_34
Description: NF14475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14475_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 34797330 - 34797124
Alignment:
| Q |
19 |
ataggtggaacaaagcatacctgaaattcagcccttataaatgctcgagcacacctcttacacgcgtccaccagatgttcaggcatgctttcatttcttc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34797330 |
ataggtggaacaaagcatacctgaaattcggcccttataaatgctcgagcacacctcttacacgcgtccactagatgttcaggcatgctttcatttcttc |
34797231 |
T |
 |
| Q |
119 |
ttagggaatcccacccacgaccacgtccatgacaaacacggcctacagccaagtccttccaaggaagctttacatcataagtctcagccgaccaaaaatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34797230 |
ttagggaatcccacccacgaccacgtccatgacaaacacggcctacagccaagtccttccaaggaagctttacatcataagtctcagccgaccaaaaatc |
34797131 |
T |
 |
| Q |
219 |
ctatgct |
225 |
Q |
| |
|
|| |||| |
|
|
| T |
34797130 |
ctttgct |
34797124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University