View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14475_low_40 (Length: 202)
Name: NF14475_low_40
Description: NF14475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14475_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 19 - 184
Target Start/End: Original strand, 43870716 - 43870880
Alignment:
| Q |
19 |
caatggcgacgcaatcttatcttgttaatctcaactccttccatgcgggaatcacaggtaactattcaactttcttgtactctttttcttatcaagcaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43870716 |
caatggcgacgcaatcttatcttgttaatctcaactccttccatgcgggaatcacaggtaactattcaactttcttgtactctctttcttatcaagcaaa |
43870815 |
T |
 |
| Q |
119 |
ccaccttcatttcacttcactcctttccattttttcaatcttgtaggacggaatccttcaatattc |
184 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43870816 |
ccaccttcatttcacttcact-ctttccattttttcaatcttgtaggacggtatccttcaatattc |
43870880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University