View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14476_high_10 (Length: 341)
Name: NF14476_high_10
Description: NF14476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14476_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 139 - 324
Target Start/End: Original strand, 24258898 - 24259083
Alignment:
| Q |
139 |
ttcatatgaagagaaacgaggattgtggaagaaagagtcaacaacctgggaaagccgggagagtttttgttggatggtatattggattgcatccatgaaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24258898 |
ttcatatgaagagaaacgaggattgtggaagaaagagtcaacaacctgggaaagccgggagagtttttgttggatggtatattggattgcatccatgaaa |
24258997 |
T |
 |
| Q |
239 |
tcacagttgcactttcctttccaaatagaatgactgattctctttacaaagttgatacaactccacgtcttgctcaatggagaatc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24258998 |
tcacagttgcactttcctttccaaatagaatgactgattctctttacaaagttgatacaactccacgtcttgctcaatggagaatc |
24259083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 19 - 125
Target Start/End: Original strand, 24258767 - 24258872
Alignment:
| Q |
19 |
atattacaaaacaatcaaaccaaagattgnnnnnnncatcatttgtatcattgtaataaataagaagaaaagtatactatagtatagtgatgaagtggta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24258767 |
atattacaaaacaatcaaaccaaagattgaaaaaa-catcatttgtatcattgtaataaataagaagaaaagtatactatagtatagtgatgaagtggta |
24258865 |
T |
 |
| Q |
119 |
gtgaaca |
125 |
Q |
| |
|
||||||| |
|
|
| T |
24258866 |
gtgaaca |
24258872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University