View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14476_high_13 (Length: 327)
Name: NF14476_high_13
Description: NF14476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14476_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 67 - 317
Target Start/End: Complemental strand, 32666986 - 32666736
Alignment:
| Q |
67 |
cttctaccattatgtctgagtttgcaaataaaaggacaagaggttcttttatagctgcggttttttctatgcaagggtttggtatattggctagtgcaac |
166 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32666986 |
cttctaccattatgtctgagtttgctaataaaaggacaagaggttcttttatagctgcggttttttctatgcaagggtttggtatattggctagtgcaac |
32666887 |
T |
 |
| Q |
167 |
tgttactatggtggtttgcttggtatttcgcagcggttcgaagccggcaacggcttttgatgtgccgccggaggctgacgttgcatggaggttgatattg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32666886 |
tgttactatggtggtttgcttggtatttcgcagcggttcgaagccggcaacggcttttgatgtgccgccggaggctgacgttgcatggaggttgatattg |
32666787 |
T |
 |
| Q |
267 |
atgattggttcagttccagctgcattgacttattattggcgtatgatgatg |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32666786 |
atgattggttcagttccagctgcattgacttattattggcgtatgatgatg |
32666736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 158
Target Start/End: Complemental strand, 37315809 - 37315765
Alignment:
| Q |
114 |
tttatagctgcggttttttctatgcaagggtttggtatattggct |
158 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| || |||||| |
|
|
| T |
37315809 |
tttatagcttcggtttttgctatgcaagggtttggaattttggct |
37315765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University