View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14476_high_13 (Length: 327)

Name: NF14476_high_13
Description: NF14476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14476_high_13
NF14476_high_13
[»] chr4 (1 HSPs)
chr4 (67-317)||(32666736-32666986)
[»] chr3 (1 HSPs)
chr3 (114-158)||(37315765-37315809)


Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 67 - 317
Target Start/End: Complemental strand, 32666986 - 32666736
Alignment:
67 cttctaccattatgtctgagtttgcaaataaaaggacaagaggttcttttatagctgcggttttttctatgcaagggtttggtatattggctagtgcaac 166  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32666986 cttctaccattatgtctgagtttgctaataaaaggacaagaggttcttttatagctgcggttttttctatgcaagggtttggtatattggctagtgcaac 32666887  T
167 tgttactatggtggtttgcttggtatttcgcagcggttcgaagccggcaacggcttttgatgtgccgccggaggctgacgttgcatggaggttgatattg 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32666886 tgttactatggtggtttgcttggtatttcgcagcggttcgaagccggcaacggcttttgatgtgccgccggaggctgacgttgcatggaggttgatattg 32666787  T
267 atgattggttcagttccagctgcattgacttattattggcgtatgatgatg 317  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
32666786 atgattggttcagttccagctgcattgacttattattggcgtatgatgatg 32666736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 158
Target Start/End: Complemental strand, 37315809 - 37315765
Alignment:
114 tttatagctgcggttttttctatgcaagggtttggtatattggct 158  Q
    ||||||||| |||||||| |||||||||||||||| || ||||||    
37315809 tttatagcttcggtttttgctatgcaagggtttggaattttggct 37315765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University