View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14476_high_14 (Length: 324)
Name: NF14476_high_14
Description: NF14476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14476_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 18 - 310
Target Start/End: Original strand, 38730558 - 38730850
Alignment:
| Q |
18 |
agcatcaccgtcgttaataactttcaaagcttgagccacatgagtcatattgggcacaaactgaagtttatccaattgggtctccaattctggaccccac |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38730558 |
agcatcaccatcgttaataactttcaaagcttgagccacatgagtcatattgggcacaaactgaagtttatccaattgggtctccaattctggaccccac |
38730657 |
T |
 |
| Q |
118 |
ttccatctcttaacaacttcaacaattttagccacagctaatgcattcaaaaaaggttttttaacctcacccaccataacatgatcatcaatacctggct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38730658 |
ttccatctcttaacaacttcaacaattttagccacagctaatgcattcaaaaaaggttttttaacctcacccaccataacatgatcatcaatacctggct |
38730757 |
T |
 |
| Q |
218 |
caactgacctaacacccttacccttataaataacactacctgattcatctaaatactcaatttcctcagtccattccttagacccagaattat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38730758 |
caactgacctaacacccttacccttataaataacactacctgattcatctaaatactcaatttcctcagtccattccttagacccagaattat |
38730850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University