View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14476_high_16 (Length: 251)
Name: NF14476_high_16
Description: NF14476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14476_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 32667098 - 32667333
Alignment:
| Q |
1 |
agcttgttagcatcaataataaggcgataccgtagacgtggcgccggccttttaggtctccgaggcgtccgaataggagctgaccgaaggcggttcctag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32667098 |
agcttgttagcatcaataataaggcgataccgtagacgtggcgccggccttttaggtctccgaggcgtccgaataggagctgaccgaaggcggttcctag |
32667197 |
T |
 |
| Q |
101 |
gagtgcgacggagacaagagctgagaccacgaccgggttgacttgacggatttcttggtggtcagagtagtatattcttcctagcatctttgtgatgagt |
200 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32667198 |
gagtgcaacggagacaagggctgagaccacgaccgggttgacttgacggatttcttggtggtcggagtagtatattcttcctagcatctttgtgatgagt |
32667297 |
T |
 |
| Q |
201 |
gtgatggagaagaggtcataagagtcagtgaaaagt |
236 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||| |
|
|
| T |
32667298 |
gtgatggaaaaaaggtcataagagtcagtgaaaagt |
32667333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University