View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14476_low_12 (Length: 328)
Name: NF14476_low_12
Description: NF14476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14476_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 176 - 315
Target Start/End: Original strand, 12884547 - 12884686
Alignment:
| Q |
176 |
tcaaaatatgagcatctgttgaatcataatacaagcaaactaatcaagatttccattcttggagaaaaattgttcaaacaacaactttagataataacat |
275 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
12884547 |
tcaaaatatgagcatctattgaatcataatacaagcaaattaatcaagatttccattcttggagaaaaattgttcaaacaacatctttagatgataacat |
12884646 |
T |
 |
| Q |
276 |
aaagcaacaatgaaaatcacaaaacaacttggattaagaa |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12884647 |
aaagcaacaatgaaaatcacaaaacaacttggattaagaa |
12884686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University