View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14476_low_6 (Length: 413)
Name: NF14476_low_6
Description: NF14476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14476_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 223 - 368
Target Start/End: Original strand, 37611684 - 37611829
Alignment:
| Q |
223 |
ttaaggtcattattttggaccagaaattgaaggcctaaaacgagggcttgactcgccttatgcttgagttagtcctgagcaacacactcgctatttatac |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37611684 |
ttaaggtcattattttggaccagaaattgaaggcctaaaacgagggcttgactcgccttatgcttgagttagtcctgagcaacacactcgctatttatac |
37611783 |
T |
|
| Q |
323 |
acgcaatctcataatttcgatgagatcattatgaattttaacttat |
368 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37611784 |
acacaatctcataatttcgatgagatcattatgaattttaacttat |
37611829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 19 - 119
Target Start/End: Original strand, 37611480 - 37611580
Alignment:
| Q |
19 |
gaacaatatgttgaaaatgattgatgagtggtgctagaaattccaaggtcgtccaacatattttgagggctgaaacaaacttaaatataaaacttttgaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37611480 |
gaacaatatgttgaaaatgattgatgagtggtgctagaaataccaaggtcgtccaacatattttgagggctgaaacaaacttaaatataaaacttttgaa |
37611579 |
T |
|
| Q |
119 |
g |
119 |
Q |
| |
|
| |
|
|
| T |
37611580 |
g |
37611580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University