View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14478_high_2 (Length: 424)
Name: NF14478_high_2
Description: NF14478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14478_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 386; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 386; E-Value: 0
Query Start/End: Original strand, 2 - 419
Target Start/End: Complemental strand, 43639777 - 43639360
Alignment:
| Q |
2 |
tgaagattttttgaacggtggtgattgtttaagtttgaattgttctatacctggtgaacaaatgttgggaaggttaataagttttgaagaaaataaaaaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43639777 |
tgaagattttttgaacggtggtgattgtttaagtttgaattgttctatacctggcgaacaaatgttgggaaggttaataagttttgaagaaaataaaaaa |
43639678 |
T |
 |
| Q |
102 |
tttaaggaatatgatgaatctttaggtatgggtgggtttgtgagggatttaaaggaggaatttaggggtttattaaaggaggtttatgtgtggcatgctt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43639677 |
tttaaggaatatgatgaatctttaggtatgggtgggtttgtgagggatttaaaggaggaatttaggggtttattaaaggaggtttatgtgtggcatgctt |
43639578 |
T |
 |
| Q |
202 |
tttgtgggtattggggtgggattaggcctaatgttgaagggatgccagagtcggtggttgtgccggcgaagttgtcaccggaggctgagaggtgtatgac |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43639577 |
tttgtgggtattggggtgggattaggcctaatgttgaagggatgccagagtcggtgataatgccggcgaagttgtcaccgggggctgagaggtgtatgac |
43639478 |
T |
 |
| Q |
302 |
ggatttggcggtggtgaagataatggaggtcggagttggattggtgaagccagaagaggcatgtcggttgtatgatggacttcattctcatttgaaatct |
401 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43639477 |
ggatttggcggtggtgaagataatggagatcggagttggattggtgaagccagaagaggcatgccggttgtatgatggacttcattctcatttgaaatct |
43639378 |
T |
 |
| Q |
402 |
gttggtattgatgatgtc |
419 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
43639377 |
gttggtattgatggtgtc |
43639360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 186 - 238
Target Start/End: Original strand, 486766 - 486818
Alignment:
| Q |
186 |
tatgtgtggcatgctttttgtgggtattggggtgggattaggcctaatgttga |
238 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||| || ||||||||||| |
|
|
| T |
486766 |
tatgtgtggcatgctttatgtggttattggggtgggataagacctaatgttga |
486818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 183 - 232
Target Start/End: Complemental strand, 34698263 - 34698214
Alignment:
| Q |
183 |
gtttatgtgtggcatgctttttgtgggtattggggtgggattaggcctaa |
232 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||| |||| ||||| |
|
|
| T |
34698263 |
gtttatgtttggcatgcactttgtgggtattggggtggggttagacctaa |
34698214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University