View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14478_high_3 (Length: 286)
Name: NF14478_high_3
Description: NF14478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14478_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 264
Target Start/End: Original strand, 11113680 - 11113924
Alignment:
| Q |
20 |
gacctagtaatgagcattttacgaaattatggtgcgaggaagaaaatggtttagtcgggaggtctgctagttggtgacttgttgcatgagagaaacattg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
11113680 |
gacctagtaatgagcattttacgaaattatggttcgaggaagaaaatggtttagtcgggaggtctgccaattggtgacttgttgcatgagagaaacattg |
11113779 |
T |
|
| Q |
120 |
agttgcttggcttctagcaggtcaggtaccaaatgataatttacgatcaagagttttatgtaggaatgaaatgaaggattattacatcaataagttgtct |
219 |
Q |
| |
|
|||||||||||| ||||||||||| || |||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11113780 |
agttgcttggctgctagcaggtcacgtgccaaatgataatttacgatcaagagtttcatgtaggaatgaaatgaagggttattacatcaataagttgtct |
11113879 |
T |
|
| Q |
220 |
gagtaggttttaggtgtatcaatcaattgaacactgatttctagc |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11113880 |
gagtaggttttaggtgtatcaatcaattgaacactgatttctagc |
11113924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University