View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14479_low_2 (Length: 339)
Name: NF14479_low_2
Description: NF14479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14479_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 21 - 321
Target Start/End: Original strand, 2335804 - 2336102
Alignment:
| Q |
21 |
ccctcctccttctttctcttccttgtgttctccctttattgtcaacactccatcaccaattgttatgttcacattctctttagggattcctggcatgtca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2335804 |
ccctcctccttctttctcttccttgtgttctccctttattgtcaacactccatcaccaattgttatgttcacattctctttagggattcctggcatgtca |
2335903 |
T |
 |
| Q |
121 |
tatttcagtttatagtggttgtcactttctttcacacgtccacttaatgaccatggtgtcaaattcatgttgttaaatagcttgttgatgttctcagttg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2335904 |
tatttcagtttatagtggttgtcactttctttcacacgtccacttaatgaccatggtgtcaaattcatgttgttaaatagcttgttgatgttctcagtta |
2336003 |
T |
 |
| Q |
221 |
cttgcattagggcatttccaagacctgatggaaataactctgaaaaattaacacaaaaaatataatgtaaggttgtgtttcatgtactcttcagtgggac |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2336004 |
cttgcattagggcatttccaagacctgatggaaataactctgaaaaattaacac--aaaatataatgtaaggttgtgtttcatgtactcttcagtgggac |
2336101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University