View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14480_high_22 (Length: 298)
Name: NF14480_high_22
Description: NF14480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14480_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 14 - 209
Target Start/End: Complemental strand, 20272861 - 20272667
Alignment:
| Q |
14 |
agagcaaaagatttataattggtttgnnnnnnngtttccttctctatttaattttctcgagttctctttcgtcataacttattattagttgataagttac |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20272861 |
agagcaaaagatttataattggtttgtttttt-gtttccttctctatttaattttctcgagttctctttcggcataacttattattagttgataagttac |
20272763 |
T |
|
| Q |
114 |
tactctgttcggcaaacagaaaaaatgtacatttaccccacttgaatttttcttatgaaactttaaataaatcttttggtacatctggaaatgcta |
209 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20272762 |
tactctcttgggcaaacagaaaaaatgtacatttaccccacttgaatttttcttatgaaactttaaataaatcttttggtacatctggaaatgcta |
20272667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University