View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14480_high_27 (Length: 268)

Name: NF14480_high_27
Description: NF14480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14480_high_27
NF14480_high_27
[»] chr2 (1 HSPs)
chr2 (1-73)||(42665965-42666037)
[»] chr1 (1 HSPs)
chr1 (217-254)||(10617195-10617232)
[»] chr4 (1 HSPs)
chr4 (217-254)||(34411464-34411501)


Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 42666037 - 42665965
Alignment:
1 ttcttgcgtgacgtttttccgtacaaaaaatttcaactacgcagagggaggaggaggaatattccaagactaa 73  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42666037 ttcttgcgtgacgtttttccgtacaaaaaatttcaactacgcagagggaggaggaggaatattccaagactaa 42665965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 217 - 254
Target Start/End: Complemental strand, 10617232 - 10617195
Alignment:
217 gtattatctgttttagaaagtactacaatgcccctatg 254  Q
    |||||||||||||| |||||||||||||||||||||||    
10617232 gtattatctgttttggaaagtactacaatgcccctatg 10617195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 217 - 254
Target Start/End: Original strand, 34411464 - 34411501
Alignment:
217 gtattatctgttttagaaagtactacaatgcccctatg 254  Q
    ||||||||||||||  ||||||||||||||||||||||    
34411464 gtattatctgttttgaaaagtactacaatgcccctatg 34411501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University