View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14480_high_31 (Length: 244)
Name: NF14480_high_31
Description: NF14480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14480_high_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 49857922 - 49858142
Alignment:
| Q |
17 |
atgatgaacaagtgagtctggaagcgcactgattctgtctttttcttctggaattgaaacctgcagctgccgccgc---------cgccgtgacactgcg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||| |||| |
|
|
| T |
49857922 |
atgatgaacaagtgagtctggaagcgcactgattctgtcttcttcttctggaattgaaagctgcagctgccgccgctgccgcagccgccgtgacattgcg |
49858021 |
T |
|
| Q |
108 |
gcggcgagtgaggacaggatagtaacaccaattggaattagtgaaaaaaggtcaaatttggtgtcctattcctaagtgtatacacaggcacattcaggcc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||||||||| |
|
|
| T |
49858022 |
gcggcgagtgaggacaggatagtaacaccaattggaattagtgaaaaaaggtcaaatttggtgtcctatccc------tatacacacgcacattcaggcc |
49858115 |
T |
|
| Q |
208 |
caggcccaaaccccaacaacacctttg |
234 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
49858116 |
caggcccaaaccccaacaacacatttg |
49858142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University