View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14480_high_38 (Length: 201)

Name: NF14480_high_38
Description: NF14480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14480_high_38
NF14480_high_38
[»] chr3 (1 HSPs)
chr3 (20-185)||(25795322-25795484)


Alignment Details
Target: chr3 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 20 - 185
Target Start/End: Original strand, 25795322 - 25795484
Alignment:
20 agaaaagaatgtgagagagattgataatgctatgatgagggaggaacaaagaaatttagaagcttttagcttccatttggttactcgctgattaacgaag 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
25795322 agaaaagaatgtgagagagattgataatgctatgatgagggaggaacaaagaaatttagaagcttttagcttccatttggttactcgctgatcaacgaag 25795421  T
120 aaaactcataaacaaaacattaattgcaccagttagtggcagctatgg-actaagtcaaaacctagt 185  Q
    |||||||| |||||||||    ||||||||| |||| ||||||||||| ||||||||||||||||||    
25795422 aaaactcagaaacaaaac----attgcaccatttagaggcagctatggaactaagtcaaaacctagt 25795484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University