View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14480_low_23 (Length: 298)

Name: NF14480_low_23
Description: NF14480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14480_low_23
NF14480_low_23
[»] chr4 (1 HSPs)
chr4 (14-209)||(20272667-20272861)


Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 14 - 209
Target Start/End: Complemental strand, 20272861 - 20272667
Alignment:
14 agagcaaaagatttataattggtttgnnnnnnngtttccttctctatttaattttctcgagttctctttcgtcataacttattattagttgataagttac 113  Q
    ||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
20272861 agagcaaaagatttataattggtttgtttttt-gtttccttctctatttaattttctcgagttctctttcggcataacttattattagttgataagttac 20272763  T
114 tactctgttcggcaaacagaaaaaatgtacatttaccccacttgaatttttcttatgaaactttaaataaatcttttggtacatctggaaatgcta 209  Q
    |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20272762 tactctcttgggcaaacagaaaaaatgtacatttaccccacttgaatttttcttatgaaactttaaataaatcttttggtacatctggaaatgcta 20272667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University