View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14480_low_24 (Length: 278)
Name: NF14480_low_24
Description: NF14480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14480_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 19 - 272
Target Start/End: Complemental strand, 41680134 - 41679881
Alignment:
| Q |
19 |
ggtgattgtgtggtggtttatgtaacaagtaataatcagagggaagctaaagttgaggaacttgaaggaggaagaacacctcaagaagaagagggaacga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41680134 |
ggtgattgtgtggtggtttatgtaacaagtaataatcagagggaagctaaagttgaggaacttgaaggaggaagaacacctcaagaagaagagggaacga |
41680035 |
T |
|
| Q |
119 |
ccgagttggcgatggatgagagcaacgttgcatttatgaagactactaatgtgggagatactattttgcttattcttgcactttgttttcattcggtttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41680034 |
ccgagttggcgatggatgagagcaacgttgcattcatgaagactactaatgtgggagatactattttgcttattcttgcactttgttttcattcggtttt |
41679935 |
T |
|
| Q |
219 |
tgaaggcatagccgttggaatttcaggttatttcgcaatccatcgttcatttca |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41679934 |
tgaaggcatagccgttggaatttcaggttatttcgcaatccatcgtttatttca |
41679881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University