View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14480_low_28 (Length: 268)
Name: NF14480_low_28
Description: NF14480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14480_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 42666037 - 42665965
Alignment:
| Q |
1 |
ttcttgcgtgacgtttttccgtacaaaaaatttcaactacgcagagggaggaggaggaatattccaagactaa |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42666037 |
ttcttgcgtgacgtttttccgtacaaaaaatttcaactacgcagagggaggaggaggaatattccaagactaa |
42665965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 217 - 254
Target Start/End: Complemental strand, 10617232 - 10617195
Alignment:
| Q |
217 |
gtattatctgttttagaaagtactacaatgcccctatg |
254 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10617232 |
gtattatctgttttggaaagtactacaatgcccctatg |
10617195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 217 - 254
Target Start/End: Original strand, 34411464 - 34411501
Alignment:
| Q |
217 |
gtattatctgttttagaaagtactacaatgcccctatg |
254 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34411464 |
gtattatctgttttgaaaagtactacaatgcccctatg |
34411501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University