View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14480_low_29 (Length: 261)
Name: NF14480_low_29
Description: NF14480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14480_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 3126149 - 3126377
Alignment:
| Q |
18 |
agaattactttttgcaagcataattattttagcctctttgtttctttttatggagcaccaatgttaaatgagatatatagagtggagatgcaaaatattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3126149 |
agaattactttttgcaagcataattattttagcctctttgtttctttttatggagcaccaatgttaaatgagatatatagagtggagatgcaaaatattc |
3126248 |
T |
 |
| Q |
118 |
agaaaataaagtataaatattactacaaagccaacatgggcactgatttgatgttccaatttaagcacaaacaattagaaacagatagcaatagcacgta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3126249 |
agaaaataaagtataaatattactacaaagccaacatgggcactgatttgatgttccaatttaagcacaaacaattagaaacagatagcaatatcacgta |
3126348 |
T |
 |
| Q |
218 |
gtagctggaattgagtgtgatgtaaatat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3126349 |
gtagctggaattgagtgtgatgtaaatat |
3126377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University