View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14480_low_33 (Length: 240)
Name: NF14480_low_33
Description: NF14480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14480_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 35212124 - 35211904
Alignment:
| Q |
1 |
tgaacttgcggcattggaaacatggaatatcggcaagctttatgagcaagctgtaaatattgaagtgcctatgtttgtacgtttgctccgctactatgct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35212124 |
tgaacttgcggcattggaaacatggaataacggcaagctttatgagcaagctgtaaatattgaagtgcctatgtttgtacgtttgctccgctactatgct |
35212025 |
T |
 |
| Q |
101 |
ggtgagacagaacagtgaaaccaataagtcgttcatttctttcttcatttatatactactgatttttggtgatattcgacctgcaatttattcaggttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35212024 |
ggtgagacagaacagtgaaaccaataagacgttcatttctctcttcatttatatactactgatttttggtgatattcgacctgcaatttattcaggttgg |
35211925 |
T |
 |
| Q |
201 |
gcagataaaatacatggtctc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35211924 |
gcagataaaatacatggtctc |
35211904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University