View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14480_low_36 (Length: 220)
Name: NF14480_low_36
Description: NF14480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14480_low_36 |
 |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0119 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 74 - 202
Target Start/End: Complemental strand, 21078 - 20950
Alignment:
| Q |
74 |
ctgagcatcgatttcactctattattaattaatttttatttgatttcttaaagaaaaatcagtgttattatgttaaaaagagatgcttgatatgtgcata |
173 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21078 |
ctgagcatcgatttctctctattattaattaatttttatttgatttcttaaagaaaaatcagtgttattatgttaaaaagagatgcttgatatgtgcata |
20979 |
T |
 |
| Q |
174 |
ttttctcaagtgttgaatattaatgcttg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20978 |
ttttctcaagtgttgaatattaatgcttg |
20950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 74 - 195
Target Start/End: Original strand, 1290303 - 1290424
Alignment:
| Q |
74 |
ctgagcatcgatttcactctattattaattaatttttatttgatttcttaaagaaaaatcagtgttattatgttaaaaagagatgcttgatatgtgcata |
173 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1290303 |
ctgagcatcgatttctctctattattaattaatttttatttgatttcttaaagaaaaatcagtgttattatgttaaaaagagatgcttgatatgtgcata |
1290402 |
T |
 |
| Q |
174 |
ttttctcaagtgttgaatatta |
195 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
1290403 |
ttttcccaagtgttgaatatta |
1290424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University