View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14480_low_39 (Length: 201)
Name: NF14480_low_39
Description: NF14480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14480_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 20 - 185
Target Start/End: Original strand, 25795322 - 25795484
Alignment:
| Q |
20 |
agaaaagaatgtgagagagattgataatgctatgatgagggaggaacaaagaaatttagaagcttttagcttccatttggttactcgctgattaacgaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25795322 |
agaaaagaatgtgagagagattgataatgctatgatgagggaggaacaaagaaatttagaagcttttagcttccatttggttactcgctgatcaacgaag |
25795421 |
T |
 |
| Q |
120 |
aaaactcataaacaaaacattaattgcaccagttagtggcagctatgg-actaagtcaaaacctagt |
185 |
Q |
| |
|
|||||||| ||||||||| ||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
25795422 |
aaaactcagaaacaaaac----attgcaccatttagaggcagctatggaactaagtcaaaacctagt |
25795484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University