View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14481_high_6 (Length: 346)
Name: NF14481_high_6
Description: NF14481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14481_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 18 - 336
Target Start/End: Complemental strand, 7007890 - 7007572
Alignment:
| Q |
18 |
atcaaaattgatgacttatcaggcgtcagccgtactttgaagctgaagcgtccttctggacgcccacaaggcacggttggcgttaaagtcatcataaaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
7007890 |
atcaaaattgatgacttatcaggcgtcagccgtactttgaagctgaagcgtccttctggacgcccacaaggcacggttgacattaaagtcatcataaaaa |
7007791 |
T |
|
| Q |
118 |
atttagcctatcatgcaccttatggtgttcctcatccttatgggaggccatatggtgctccacctgcacctggtgcaagtttgtcggtaacgtatgggaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7007790 |
atttagcctatcatgcaccttatggtgttcctcatccttatgggagtccatatggtgctccacctgcacctggtgcaagtttgtcagtaacgtatgggaa |
7007691 |
T |
|
| Q |
218 |
tccatacaatgttgctccacctccgcctgcaggctacggctaccctgtagccgcacccacgtatgttgctgcctcacgtcctcctgtaggttaccccgca |
317 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7007690 |
tccatacaatgttgctccacctctgcctgcaggctacggctaccctgtagccgcacccacgtatgttgctgcctcacgtcctcctgtaggttaccccgca |
7007591 |
T |
|
| Q |
318 |
tctgcaccatatgcctatg |
336 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
7007590 |
tctgccccatatgcctatg |
7007572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University