View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14481_low_10 (Length: 218)
Name: NF14481_low_10
Description: NF14481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14481_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 24240925 - 24240735
Alignment:
| Q |
18 |
gaaacagttaccttttgctgcactatagatagttcctatatttagtgatgctacaccaccaatggaggacaggaaaacgatgcttgcattgtttgaagct |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24240925 |
gaaatagttaccttttgctgcactatagatagttcctatatttagtgatgctacaccaccaatggaggacatgaaaacgatgcttgcattgtttgaagct |
24240826 |
T |
|
| Q |
118 |
ttgagtagtggatgtgcaagctggcttatgtgaaaagcagattcaagattggtattcaccagaaatgagaaatcttgctcagtataatcta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24240825 |
ttgagtagtggatgtgcaagctggcttatgtgaaaagcagattcaagattggtattcaccagaaatgagaaatcttgctcagtaaaatcta |
24240735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University