View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14481_low_9 (Length: 234)
Name: NF14481_low_9
Description: NF14481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14481_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 13 - 214
Target Start/End: Original strand, 34880121 - 34880322
Alignment:
| Q |
13 |
taaggaaatattacaaataagatattataaaggagatgagaaactatgataatctaactgattgaaccacaaatgattcagatcatatgtgaagttttga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880121 |
taaggaaatattacaaataagatattataaaggagatgagaaactatgataatctaactgattgaaccacaaatgattcagatcatatgtgaagttttga |
34880220 |
T |
 |
| Q |
113 |
aaattaaccttgatccacccccaaacttgatttttgacttgttccatgatttgatcttgagattgttctttgtgaatgaaaaacctgttattatgttcca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880221 |
aaattaaccttgatccacccccaaacttgatttttgacttgttccatgatttgatcttgagattgttctttgtgaatgaaaaacctgttattatgttcca |
34880320 |
T |
 |
| Q |
213 |
ac |
214 |
Q |
| |
|
|| |
|
|
| T |
34880321 |
ac |
34880322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University