View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14482_high_4 (Length: 283)
Name: NF14482_high_4
Description: NF14482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14482_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 81 - 269
Target Start/End: Original strand, 8004304 - 8004492
Alignment:
| Q |
81 |
caaccaaacataccctaggagatgttagtttatttggagatagtagagtttcattggtttgatatgggtcatcatatggcaaggggacacgtatggataa |
180 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8004304 |
caaccaaacatatcctaagagatgttagtttatttggagatagtagagtttaattggtttgatatgggtcatcatatggcaaggggacacgtatgaataa |
8004403 |
T |
|
| Q |
181 |
atgtgttgatataatatgataattaggagaaagaacaacttttcttagttcttacttccctcgtttctaaataattaacatgtttttgg |
269 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
8004404 |
atgtgttgatataagatgataattaggagaaagaataacttttcttagttcttacttccgtcatttctaaataattaacatgtttttgg |
8004492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University