View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14482_low_7 (Length: 250)
Name: NF14482_low_7
Description: NF14482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14482_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 95 - 225
Target Start/End: Complemental strand, 28596368 - 28596238
Alignment:
| Q |
95 |
gccttaattctctctctgttttaatttttgcatactaaggtcacatacacacacgttgcaatgtgtgttaaaagtcaaacgtttgtgtcctattggagga |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28596368 |
gccttaattctctctctgttttaatttttgcatactaaggtcacatacacacacgttgcaatgtgtgttaaaagtcaaacgtttgtgtcctattggagga |
28596269 |
T |
|
| Q |
195 |
gttaaggaataggatacaccaaattgtgcca |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28596268 |
gttaaggaataggatacaccaaattgtgcca |
28596238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 28596462 - 28596425
Alignment:
| Q |
1 |
ctaacggttgaaatgacataaaaaaccttaggtaagca |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28596462 |
ctaacggttgaaatgacataaaaaaccttaggtaagca |
28596425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University